Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (95)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Anto, R. J.
Right arrow Articles by Aggarwal, B. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Anto, R. J.
Right arrow Articles by Aggarwal, B. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Carcinogenesis, Vol. 23, No. 9, 1511-1518, September 2002
© 2002 Oxford University Press


CARCINOGENESIS

Cigarette smoke condensate activates nuclear transcription factor-{kappa}B through phosphorylation and degradation of I{kappa}B{alpha}: correlation with induction of cyclooxygenase-2

Ruby John Anto, Asok Mukhopadhyay, Shishir Shishodia, C. Gary Gairola1 and Bharat B. Aggarwal,2

Cytokine Research Laboratory, Department of Bioimmunotherapy, Box 143, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030 and
1 Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, KY 40536-0082, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cigarette smoke (CS) contains several carcinogens known to initiate and promote tumorigenesis and metastasis. Because various genes that mediate carcinogenesis and tumorigenesis are regulated by nuclear factor-{kappa}B (NF-{kappa}B), we postulated that the effects of CS must be mediated through activation of this transcription factor. Therefore, in the present report we investigated whether cigarette smoke condensate (CSC) activates NF-{kappa}B, and whether the pathway employed for activation is similar to that of TNF, one of the potent activators of NF-{kappa}B. Our results show that the treatment of human histiocytic lymphoma U-937 cells with CSC activated NF-{kappa}B in a dose- and time-dependent manner. The kinetics of NF-{kappa}B activation by CSC was comparable with that of TNF. CSC-induced NF-{kappa}B activation was not cell type-specific, as it also activated NF-{kappa}B in T cells (Jurkat), lung cells (H1299), and head and neck squamous cell lines (1483 and 14B). Activation of NF-{kappa}B by CSC correlated with time-dependent degradation of I{kappa}B{alpha}, an inhibitor of NF-{kappa}B. Further studies revealed that CSC induced phosphorylation of the serine residue at position 32 in I{kappa}B{alpha}. In vitro immunocomplex kinase assays showed that CSC activated I{kappa}B{alpha} kinase (IKK). The suppression of CSC-activated NF-{kappa}B-dependent reporter gene expression by dominant negative form of I{kappa}B{alpha}, TRAF2, NIK and IKK suggests a similarity to the TNF-induced pathway for NF-{kappa}B. CSC also induced the expression of cyclooxygenase-2, an NF-{kappa}B regulated gene product. Overall, our results indicate that through phosphorylation and degradation of I{kappa}B{alpha}, CSC can activate NF-{kappa}B in a wide a variety of cells, and this may play a role in CS-induced carcinogenesis.

Abbreviations: B[a]P, benzo[a]pyrene; COPD, chronic obstructive pulmonary disease; COX-2, cyclooxygenase; CS, cigarette smoke; CSC, cigarette smoke condensate; EMSA, electrophoretic mobility shift assay; IL, interleukin; NF-{kappa}B, nuclear transcription factor-{kappa}B


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cigarette smoke (CS) is a major risk factor for a number of diseases including cancer, chronic obstructive pulmonary disease (COPD) and cardiovascular disease. Smokers exhibit high incidence of lung cancer, which is the leading cause of cancer mortality in men and women (1). Both active and passive smoking have been implicated in lung cancer. Additionally, cancers of the other sites, e.g. larynx, oral cavity, pharynx, esophagus, pancreas, kidney and bladder are also associated with smoking. Worldwide, 15% of all cancer cases are attributed to CS. Recent estimates indicates that CS causes ~80–90% of lung cancer in the US (2).

CS is a complex chemical mixture containing ~4800 different compounds, of which ~100 are known carcinogens, co-carcinogens, mutagens and/or tumor promoters (3). Metabolites of tobacco-specific N-nitrosamines, like 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and polycyclic aromatic hydrocarbons, like diolepoxides of benzo[a]pyrene (B[a]P) are believed to be the primary tobacco carcinogens (4), although other smoke constituents like high levels of free radicals may also play a role. For example each puff of smoke contains over 10 trillion free radicals present in both mainstream and sidestream smoke, which also may contribute to both tumor initiation as well as promotion. One common feature in the pathogenesis of various smoking-associated diseases is inflammation. Yet, the mechanisms underlying the role of smoking in these diseases is presently unknown or poorly understood. Additionally, exposure of cells to B[a]P also mutates p53 gene at the same location as found in 60% of lung cancer patients (5). A tobacco-specific N-nitrosamine or cigarette smoke condensate (CSC) causes neoplastic transformation of xenotransplanted human bronchial epithelial cells (6).

Nuclear transcription factor-{kappa}B (NF-{kappa}B) is a ubiquitous nuclear transcription factor that plays a major regulatory role in inflammation. It resides in the inactive state in cytoplasm as a heterotrimer consisting of p50, p65,and I{kappa}B{alpha} subunits. This transcription factor is a dimeric complex composed of different members of the Rel/NF-{kappa}B family of polypeptides (for refs, see 7). The p50–p65 heterodimer is retained in the cytoplasm by the inhibitory subunit I{kappa}B{alpha}. On activation of the complex, I{kappa}B{alpha} sequentially undergoes phosphorylation, ubiquitination and degradation, thus releasing the p50–p65 heterodimer for translocation to the nucleus. An I{kappa}B{alpha} kinase, IKK, has been identified that phosphorylates serine residues in I{kappa}B{alpha} at position 32 and 36 (8). Treatment of cells with various inflammatory and oxidative stress stimuli activates the IKK, thus leading to the degradation of I{kappa}B{alpha} and activation of the transcription factor.

Whether CS or its components cause tumor development through the NF-{kappa}B activation pathway is not understood. We postulate that the effects of CS in tumorigenesis are mediated through NF-{kappa}B activation for several reasons: (i) CS is known to increase oxidative stress and the latter is known to activate NF-{kappa}B; (ii) NF-{kappa}B activation has been implicated in chemical carcinogenesis and tumorigenesis (9,10); (iii) expression of several genes, such as cyclooxygenase (COX)-2, MMP-9, iNOS, TNF, interleukin (IL)-8, cell surface adhesion molecules, and antiapoptotic proteins involved in tumor initiation, tumor promotion, and metastasis are regulated by NF-{kappa}B (for refs, see 11). Therefore, in the present report we investigated whether CSC can activate NF-{kappa}B, and whether the pathway employed for activation is similar to that of TNF, an inducer of NF-{kappa}B with a well-defined pathway. We demonstrate that CSC activates NF-{kappa}B in a wide variety of different cell types and that this activation is mediated through induction of IKK leading to phosphorylation and degradation of I{kappa}B{alpha}.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials
Bacteria-derived human rTNF with a specific activity of 5x107 U/mg, was a kind gift from Genentech (South San Francisco, CA). Penicillin, streptomycin, RPMI 1640 medium and FBS were obtained from Life Technologies (Grand Island, NY). Tris, glycine, NaCl, SDS, PMA and BSA were obtained from Sigma Chemical (St Louis, MO). Rabbit polyclonal antibodies to I{kappa}B{alpha}, p50 and p65 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). I{kappa}B{alpha}-Ser32-phospho-specific polyclonal antibodies were obtained from New England BioLab (Beverly, MA). Monoclonal antibodies to IKK{alpha} and IKKß were kindly provided by Imgenex (San Diego, CA) and antibodies against COX-2 were obtained from Transduction Laboratories (Lexington, KY). Expression plasmids encoding FLAG-tagged NIK (12) were kindly provided by Dr David Wallach (Weizmann Institute of Science, Rehovot, Israel). The expression plasmids encoding myc-tagged TRAF2, NIK, p65 and dominant negative (DN)-I{kappa}B{alpha} have been described previously (13).

Cell culture
Human histiocytic lymphoma (U937), human epithelial (HeLa) and human T (Jurkat) cells were obtained from American Type Culture Collection (IL). Human lung epithelial cells (H1299), human head and neck cancer cell lines (14B and 1483) were kindly supplied by Dr Reuben Lotan (University of Texas M. D. Anderson Cancer Center, Houston, TX). U937 and Jurkat cells were grown in RPMI-1640 containing 10% FBS, A293 and HeLa cells were grown in MEM containing 10% FBS, and the remaining three cell lines were cultured in DMEM/F12 containing 10% FBS. Cells were subcultured every 3 days. For most studies human monocytic cell line U937 was used because a significant amount of information is available about the mechanism of NF-{kappa}B activation in these cells and this cell line is routinely employed in our laboratory to study NF-{kappa}B.

Preparation of CSC
The CSC was prepared from the University of Kentucky Reference Cigarette 1R4F (9 mg tar and 0.8 mg nicotine/cigarette). The `tar' or particulate phase of smoke was collected on a Cambridge filter pad from cigarettes using a smoking machine set to a 35 ml puff vol of 2 s duration under standard conditions prescribed by Federal Trade Commission (14). The smoke particulate matter was dissolved in DMSO at 40 mg/ml, aliquoted into small vials and stored frozen at –80°C. On the day of the experiment, each vial of CSC solution was opened and diluted in the serum-free cell culture medium to desired concentration, vortexed vigorously and used for treatment of cells. Control cells were treated with medium containing an equivalent amount of DMSO. Repeated freezing and thawing of the CSC solution was avoided as much as possible.

Electrophoretic mobility shift assay (EMSA)
U937 cells (2x106/ml) were treated with different concentrations of either CSC (0, 0.01, 0.1, 1 or 10 µg/ml) or TNF (0, 0.01, 0.1 or 1 nM) in serum-free medium for 30 min at 37°C for dose–response and 10 ug/ml CSC or 0.1 nM TNF at 0, 5, 15, 30, 60 and 120 min. NF-{kappa}B activation was analyzed by EMSA as described (15). In brief, 8-µg nuclear extracts prepared from CSC-treated or untreated cells were incubated with 32P-end-labeled 45mer double-stranded NF-{kappa}B oligonucleotide from human immunodeficiency virus-1 long terminal repeat (5'-TTGTTACAA GGGACTTTCCGCTGGGGACTTTCCAG GGAGGCGTGG-3'; underline sequence indicates the binding site) for 15 min at 37°C, and the DNA–protein complex resolved in a 6.6% native polyacrylamide gel. The specificity of binding was examined by competition with unlabeled 100-fold excess oligonucleotide and with mutant oligonucleotide. The composition and specificity of binding was also determined by supershift of the DNA–protein complex using specific and irrelevant antibodies. For the supershift experiment, the antibody-treated samples of NF-{kappa}B were resolved on a 5% native gel. The radioactive bands from the dried gels were visualized and quantified by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using ImageQuant software (Molecular Dynamics).

IKK assay
The IKK assay was performed by a method described earlier (16). Briefly, IKK signalosomes were precipitated by treating 300 µg of cytoplasmic extracts with 1 µg IKK{alpha} antibody, followed by treatment with 20 µl protein A/G Sepharose (Pierce). The beads were washed three times with lysis buffer and three times with kinase assay buffer. Beads were then resuspended in 20 µl kinase assay mixture containing 50 mM HEPES (pH 7.4), 20 mM MgCl2, 2 mM DTT, 20 µCi {gamma}-ATP, 10 µM unlabeled ATP and 2 µg substrate [GST-I{kappa}B{alpha} (1–54)]. The mixture was incubated at 30°C for 30 min, and the reaction was terminated by adding 5 µl of 5x SDS sample buffer and boiling for 5 min. Finally, the protein was resolved on 10% acrylamide gel under reducing conditions. The gel was dried, and the radioactive bands were visualized by PhosphorImager as described previously. To determine the total amounts of IKK{alpha} and IKKß in each sample, 60 µg of cytoplasmic proteins were resolved on 7.5% acrylamide gels. Resolved samples were electrotransferred to nitrocellulose membranes, and the membranes were blocked with 5% non-fat milk protein for 1 h and incubated separately with IKK{alpha} and IKKß antibodies (1:500) for 1 h. The membrane was washed and treated with HRP-conjugated secondary antibodies and finally detected by chemiluminescence (ECL, Amersham Pharmacia Biotech., Arlington Heights, IL).

Western blot analysis
Thirty to sixty micrograms of whole-cell protein was resolved on 10% SDS–PAGE gel. The protein was transferred to a nitrocellulose membrane, blocked with 5% non-fat milk, and probed with specific antibodies against I{kappa}B{alpha} (1:3000), phospho-I{kappa}B{alpha} (1:1000) and COX-2 (1:1000) separately. The blots were washed, exposed to HRP-conjugated secondary antibodies for 1 h, and finally detected by ECL reagent (Amersham Pharmacia Biotech.). For COX-2 assays, whole-cell extracts were prepared from treated cells (2x106 cells in 2 ml medium) and resolved on 7.5% SDS–polyacrylamide gels.

NF-{kappa}B SEAP reporter assay
The effect of TNF and CSC on NF-{kappa}B-SEAP reporter gene expression assay was based on our earlier report (13). Briefly, 293 and Hela cells (0.6x106 cells/well) were plated in 6 well plates, and cells were transfected by the calcium phosphate method (Gibco BRL) with various plasmids. At 12 h post-transfection, CSC or TNF was added to the wells in fresh serum-free medium and incubated for an additional 12 h. The supernatants were collected and assayed for SEAP activity. For this, the supernatants were centrifuged for 2 min at 13 000 g, and 25 µl of each sample was incubated with 75 µl of SEAP buffer (500 mM Tris pH 9.0 containing 0.5% BSA) at 65°C for 30 min. The plate was chilled on ice for 2 min. Then 50 µl of 1 mM 4-methylumbelliferyl phosphate was added to each well and incubated at 37°C for 2 h. The activity of SEAP was assayed on a 96 well fluorescence plate reader (Fluoroscan II labsystems, Needham, Heights, MA) with excitation set at 360 nm and emission at 460 nm.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several genes that are implicated in chemical carcinogenesis and tumorigenesis are regulated by NF-{kappa}B. Because of the critical role of NF-{kappa}B in these processes, we investigated the effect of CSC on NF-{kappa}B activation. Because the mechanism of NF-{kappa}B activation by TNF is better understood, throughout we used this cytokine as a control for comparison with CSC.

CSC activates NF-{kappa}B in dose- and time-dependent manner
To investigate the effect of CSC on NF-{kappa}B activation, U937 cells were treated with variable concentrations of either TNF for 30 min or CSC for 60 min, nuclear extracts prepared and NF-{kappa}B activation examined by EMSA. As shown in Figure 1AGo, TNF activated NF-{kappa}B at 0.1 nM and produced a slight additional increase at 1 nM. CSC activated NF-{kappa}B at 0.1 µg/ml and reached optimum activation at 1–10 µg/ml. To examine the kinetics of NF-{kappa}B activation, cells were treated with either 0.1 nM TNF or with 10 µg/ml CSC for different times. The result shown in Figure 1BGo indicates that an optimum NF-{kappa}B activation by CSC could be seen within 15 min, which was comparable with the kinetics of TNF.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 1. CSC activates NF-{kappa}B. (A) Dose-dependent activation of NF-{kappa}B. Two million U937 cells in 1 ml were treated with different concentrations of either CSC or TNF for 30 min, and the nuclear extracts were prepared, and assayed for NF-{kappa}B by EMSA as described in the Materials and methods. (B) Time course for activation of NF-{kappa}B. Two million U937 cells in 1 ml were treated with either 0.1 nM TNF or 10 µg/ml CSC for different times. The nuclear extracts were prepared and assayed for NF-{kappa}B by EMSA as described in the Materials and methods.

 
CSC-activated NF-{kappa}B consists of p50 and p65 subunits
Various combinations of Rel/NF-{kappa}B proteins can constitute an active NF-{kappa}B heterodimer that binds to specific sequences in DNA (17). To show that the retarded band visualized by EMSA in CSC-treated cells was indeed NF-{kappa}B, we incubated nuclear extracts from CSC/TNF-activated cells with antibody to either the p50 (NF-{kappa}BI) or p65 (Rel A) subunits and then conducted EMSA. Antibodies to either subunit of NF-{kappa}B decreased the DNA binding (Figure 2Go), thus suggesting that the TNF-activated complex consisted of p50 and p65 subunits. Pre-immune serum had no affect on the mobility of NF-{kappa}B. Excess unlabeled NF-{kappa}B (100-fold) caused complete disappearance of the band but mutant oligo did not, indicating the specificity of NF-{kappa}B. These EMSA results thus suggest that CSC induced NF-{kappa}B activation in monocytic U937 cells.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2. CSC-induced NF-{kappa}B is composed of p50 and p65 subunits. Nuclear extracts prepared from CSC (10 µg/ml)-treated cells were incubated at 37°C for 30 min with either no antibodies, or anti-p50 antibodies, or anti-p65 antibodies, or a mixture of anti-p50 and anti-p65 antibodies, or pre-immune sera, or unlabeled oligo, or mutant oligo, and then assayed for NF-{kappa}B as described in the Materials and methods.

 
Activation of NF-{kappa}B by CSC is not cell type-specific
That distinct signal transduction pathways could mediate NF-{kappa}B induction in epithelial and lymphoid cells has been demonstrated (18–20). All the effects of CSC described thus far were with U937 cells. Whether CSC could activate NF-{kappa}B in cell types other than myeloid cells, was investigated. To probe whether CSC also activates NF-{kappa}B in other cells, T-cell (Jurkat), lung cancer cell (H1299) and squamous cell carcinoma (1483 and 14B) were treated with CSC and nuclear extracts were analyzed by EMSA. CSC activated NF-{kappa}B in all four cell types tested, although the activation was low compared with that by TNF (Figure 3Go). The results indicate that CSC can activate NF-{kappa}B in a wide variety of different cell types.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 3. CSC-induced NF-{kappa}B activation is not specific to cell type: two million cells in 1 ml were treated with either CSC (10 µg/ml) or TNF (0.1 nM) for 30 min. The nuclear extracts were then prepared and assayed for NF-{kappa}B by EMSA as described in the Materials and methods.

 
CSC induces degradation of I{kappa}B{alpha}
In the previous sections, we have seen that CSC activates NF-{kappa}B in different cell lines, but it was not clear how NF-{kappa}B is activated. Although TNF-induced NF-{kappa}B activation requires degradation of I{kappa}B{alpha} (21), no I{kappa}B{alpha} degradation occurs for NF-{kappa}B activated by H2O2, X-rays, {gamma}-radiation and pervanadate treatment (22–26). Thus, whether CSC activates NF-{kappa}B through I{kappa}B{alpha} degradation was an open question. To determine this, we treated U937 cells with CSC for 0–120 min, prepared the cytoplasmic extracts, and assayed for the I{kappa}B{alpha} degradation by western blot analysis. As shown in Figure 4AGo (right top panel), I{kappa}B{alpha} degradation began to occur at 15 min of CSC treatment and was almost complete at 60 min. For comparison, TNF-induced the degradation of I{kappa}B{alpha} could be seen as early as 5 min and was complete by 10 min. These results indicate that CSC-induced NF-{kappa}B activation, like TNF-induced activation, is accompanied by I{kappa}B{alpha} degradation.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. (A) CSC induces degradation of I{kappa}B{alpha}. Two million U937 cells per ml were treated with either 0.1 nM TNF or 10 µg/ml CSC for different times. The cytoplasmic extracts were prepared and assayed for I{kappa}B{alpha} by western blot using I{kappa}B{alpha}-specific antibodies. (B) CSC activates I{kappa}B{alpha} kinase. Two million U937 cells per milliliter were treated with either 0.1 nM TNF or with 25 µg/ml CSC for different times. Thereafter the cytoplasmic extracts were prepared and assayed for IKK by the immunocomplex kinase assay (upper panel) and for IKK{alpha} (middle panel) and IKKß (lower panel) protein by western blot analysis as described in Materials and methods.

 
CSC induces the activation of I{kappa}B{alpha} kinase
TNF-induced I{kappa}B{alpha} degradation requires phosphorylation of I{kappa}B{alpha} at serine 32 and 36 (27). NF-{kappa}B activation by pervanadate and H2O2, however, require phosphorylation of I{kappa}B{alpha} at tyrosine 42 (28–30). The phosphorylation of I{kappa}B{alpha} at serine 32 requires the activation of IKK (31). As CSC phosphorylated I{kappa}B{alpha} at serine 32, we directly examined the activation of IKK by immunoprecipitation of IKK using specific antibodies followed by immunocomplex kinase assays using GST–I{kappa}B{alpha} as a substrate. CSC activated IKK within 15 min of treatment (Figure 4BGo, upper right panel) whereas TNF activated IKK within 5 min. Kinase activation was not due to the synthesis of IKK{alpha} and IKKß proteins, as their levels as revealed by western blot analysis were unaffected (Figure 4BGo, lower two panels). These results suggest that the mechanism of activation of NF-{kappa}B by CSC was similar to that by TNF.

CSC activates NF-{kappa}B-dependent reporter gene expression
Although we had shown by EMSA that CSC induced the NF-{kappa}B activation, I{kappa}B{alpha} phosphorylation and degradation, and IKK activation, DNA binding alone does not always correlate with NF-{kappa}B-dependent gene transcription, suggesting there are additional regulatory steps (32). To determine the effect of CSC on NF-{kappa}B-dependent reporter gene expression, we transiently transfected the A-293 cells with the SEAP reporter construct and then treated them with different concentrations of CSC. An almost 2-fold increase in SEAP activity over the untreated vector control was noted upon stimulation with CSC (Figure 5AGo). In contrast, TNF induced a 4-fold activation of the NF-{kappa}B SEAP gene reporter construct. To ascertain that CSC can activate NF-{kappa}B reporter gene expression in other cell types, we transfected human epithelial HeLa cells with the reporter construct and activated with either TNF or CSC. Again both TNF and CSC induced a significant NF-{kappa}B-reporter activity (Figure 5BGo). These results demonstrate that CSC-induced NF-{kappa}B was transcriptionally active and the effects were not cell type-specific.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. CSC activates NF-{kappa}B-dependent reporter gene expression. (A) Cell line 293 cells (0.6x106 cells/well) were seeded in 6 well plates and transfected with 0.5 µg SEAP and 2 µg PCMV Flag plasmids. After 24 h incubation, fresh serum-free medium containing different concentrations of CSC (1–10 µg/ml) or TNF (1 nM) were added and incubated for 12 h. The supernatant was collected and assayed for SEAP activity as described in Materials and methods. (B) HeLa cells (0.5x106) were seeded in 6 well plates and transfected with 0.5 µg SEAP and 2 µg PCMV plasmids. After 24 h incubation, fresh serum-free medium containing different concentrations of CSC (0.1–10 µg /ml) or TNF (1 nM) were added and incubated for 12 h. The supernatant was collected and assayed for SEAP activity as described in Materials and methods.

 
DN-I{kappa}B{alpha}, DN-TRAF2, DN-NIK and DN-IKK supress CSC-induced NF-{kappa}B-dependent reporter gene expression
TNF-induced NF-{kappa}B activation is mediated through sequential interaction of the TNF receptor (TNFR1) with TRADD, TRAF2, NIK and IKK-ß, resulting in phosphorylation of I{kappa}B{alpha} (12,31,33,34). To delineate the CSC-signaling pathway leading to NF-{kappa}B activation, cells were transiently transfected with DN-TRAF2, DN-NIK and DN-IKK plasmids, along with NF-{kappa}B-SEAP plasmid, and the NF-{kappa}B-dependent SEAP expression was then monitored in CSC-treated cells. TNF-induced NF-{kappa}B activation served as a control. Suppression of TNF- or CSC-induced NF-{kappa}B reporter activity by the DN-I{kappa}B{alpha} plasmid indicates that this assay is quite specific (Figure 6Go). NF-{kappa}B reporter expression induced by both TNF (upper panel) and by CSC was inhibited by transfection of cells with the plasmids expressing DN-TRAF2, DN-NIK and DN-IKK. These results suggest that the pathway by which CSC activates NF-{kappa}B is similar to that of TNF.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. CSC-induced NF-{kappa}B-dependent reporter gene expression is suppressed by DN-I{kappa}B{alpha}, DN-TRAF2, DN-NIK and DN-IKK. Line 293 cells (0.6x106 cells/well) were seeded in 6 well plates and transfected with 0.5 µg SEAP, along with 1 µg of any of the indicated DN-plasmids and 1 µg PCMV flag. At 12 h after transfection, 5 µg/ml CSC or 0.1 nM TNF was added to the wells in fresh serum-free medium and incubated for 12 h. The supernatants were collected and assayed for secreted alkaline phosphatase (SEAP) activity as described in Materials and methods. Results are expressed as fold activity over the non-transfected control.

 
CSC induces expression of COX-2
So far our results indicate that CSC activates NF-{kappa}B through activation of IKK leading to phosphorylation and degradation of I{kappa}B{alpha} and that this NF-{kappa}B is transcriptionally active. Whether CSC-induced NF-{kappa}B activation correlates with induction of COX-2, a gene regulated by NF-{kappa}B (35), was examined. U937 cells were treated with CSC for different times, the whole-cell extracts prepared and analyzed by western blot for the expression of COX-2 (Figure 7AGo). CSC induced COX-2 expression at 4 h and expression reached maximum at 12 h. Like CSC, TNF also induced COX-2 expression, which reached maximum at 8 h. These results indicate that CSC also induces COX-2, an NF-{kappa}B regulated gene product. We have shown above that CSC induces NF-{kappa}B-dependent reporter gene expression. Whether CSC also induces COX-2 expression in A293 cells was examined. As shown in Figure 7BGo, CSC induced COX-2 in a time-dependent manner. These results indicate that induction of COX-2 by CSC is not cell type-specific.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7. CSC induces COX-2 gene product. (A) Two million U937 cells were incubated with 0.1 nM TNF or 10 µg/ml CSC in serum-free medium for the indicated time intervals. Whole-cell lysates were prepared and 60 µg protein was loaded on gels and analyzed for COX-2 by western blot using COX-2-specific antibodies as described in Materials and methods. (B) Two million A293 cells were incubated with 10 µg/ml CSC in serum-free medium for the indicated time period. Whole-cell lysates were prepared and 80 µg protein was loaded on gels and analyzed for COX-2 by western blot using COX-2-specific antibodies as described in Materials and methods.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In the present report we investigated the molecular basis by which CS could mediate carcinogenesis and atherogenesis. Because of the critical role of NF-{kappa}B in carcinogenesis and atherogenesis, we investigated the ability of CSC to activate NF-{kappa}B. Our results clearly demonstrate that CSC can activate NF-{kappa}B as indicated by the formation of NF-{kappa}B–DNA complex, phosphorylation and degradation of I{kappa}B{alpha}, activation of I{kappa}B{alpha} kinase, activation of NF-{kappa}B-dependent reporter gene transcription, and expression of COX-2 a gene product regulated by NF-{kappa}B. Our results also indicate that the activation of NF-{kappa}B by CSC is not cell type-specific and occurs in lymphoid, myeloid and epithelial cells. Our results also show that the pathway through which CSC activates NF-{kappa}B is very similar to that of TNF.

The chemical moiety in the CSC that activates NF-{kappa}B is not, however, clear. CS is an aerosol of complex chemical composition containing both organic and inorganic compounds, of which 4800 have been identified so far (36). Both vapor phase and particulate phase of smoke are known to possess free radicals (37,38). While the gas phase radicals are generally short-lived, the radicals in the particulate phase are relatively stable and consist of a hydroquinone–semiquinone–quinone complex. (39). This complex is an active redox system capable of reducing molecular oxygen to produce superoxide, eventually leading to hydrogen peroxide and hydroxyl radicals. Another important constituent of CS are metals like cadmium and nickel, which have a long half-life. In addition, at least 40 different CS carcinogens have been implicated in tumor initiation and promotion (40). These cacinogens include nitrosamine, polynuclear aromatic hydrocarbons, aromatic amines, unsaturated aldehydyes (e.g. crotonaldehyde) and some phenolic compounds (acrolein). The most potent carcinogenic agent contained in CS is the NNK, formed by nitrosation of nicotine; it is thought to be an important etiological factor in tobacco smoke-related human cancers (41). NNK is a site-specific carcinogen in that irrespective of the route of admininstration, NNK has remarkable specificity for the lung (42).

H2O2, a constituent of the CS, is known to activate NF-{kappa}B (30). It is unlikely, however, that NF-{kappa}B activation observed in our studies was due to H2O2 present in the CSC. Because first, particulate matter of CSC contains very little H2O2 (43); secondly, H2O2 activates NF-{kappa}B not through serine but tyrosine phosphorylation of I{kappa}B{alpha} (30). NO2, another constituent of CSC (44), also is unlikely because it is not known to activate NF-{kappa}B. The CSC also contains B[a]P, a well-known potent carcinogen. Two recent reports indicate that B[a]P can activate NF-{kappa}B (45,46). It is unlikely, however, that in our studies the activation of NF-{kappa}B is due to the B[a]P present in CSC. First, the concentration of B[a]P in CSC is not sufficient to activate NF-{kappa}B; secondly, the level of NF-{kappa}B binding activity observed following treatment with B[a]P is very minimal as compared with that noted in our studies (45,46). Whether NNK, a lung carcinogen, can activate NF-{kappa}B, however, is not clear. Some of our preliminary studies indicate that NNK alone is not sufficient to activate NF-{kappa}B. Thus, it is quite probable that NF-{kappa}B activation observed in our studies is due to a mixture of inducers present in the CSC.

Our results indicate that CSC can activate NF-{kappa}B in a wide variety of cells including myeloid cells, lymphoid cells, lung epithelial cells and in head and neck squamous cell carcinoma cells. Whether CSC activates NF-{kappa}B in all these cell types through identical mechanism is, however, not clear. Published reports indicate that the mechanism of NF-{kappa}B activation may vary from one cell type to another (19,20). For instance, protein kinase C inhibitor calphostin C, blocked NF-{kappa}B activation by TNF in Jurkat cells but not in MCF-7 A/Z cells (19). Similarily, PTEN, a dual specificity lipid phosphatase, inhibited TNF-induced NF-{kappa}B activation in PC-3 cells but not in DU145 cells, both prostate cancer cell lines (20).

Our results demonstrate that CSC activates NF-{kappa}B through IKK activation leading to I{kappa}B{alpha} phosphorylation and degradation. Recently Gebel and Muller (47) showed that treatment of 3T3 murine fibroblast cells with CS-bubbled PBS causes a decrease in NF-{kappa}B activation during the first 2 h followed by an increase at 4 and 6 h. Although not clear from the data, the results suggest that 3T3 cells must have constitutive NF-{kappa}B to be downregulated by the smoke-bubbled PBS. Besides no supershift by the antibodies against the NF-{kappa}B protein or competition by excess unlabeled oligo probe was shown, to suggest it is indeed NF-{kappa}B that was being modulated by the smoke-bubbled PBS. Therefore, it is not too surprising that authors found no phosphorylation or degradation of I{kappa}B{alpha} in their experiments (47). Furthermore, it should be pointed out that the CSC preparation used in our study contained both water-soluble and insoluble constituents of smoke as compared with smoke-bubbled PBS used in the above study, which probably contained largely water-soluble fraction of smoke. Our results also indicate that CSC-induced NF-{kappa}B activation is blocked by DN TRAF-2, NIK and IKK. This suggests that CSC activates NF-{kappa}B through a pathway very similar to that of TNF. Although TNF-induced NF-{kappa}B activation is also blocked by DN forms of TRAF-2 and NIK, the deletion of genes for TRAF2 or NIK have no effect on TNF-induced NF-{kappa}B activation (33,34), suggesting an alternate pathway. Gene deletion for receptor-interacting protein or MEKK3, however, has been shown to abrogate the TNF-induced NF-{kappa}B activation (48–50). Whether RIP or MEKK3 also mediate CSC-induced NF-{kappa}B activation is not known at present. Like TNF, CSC-induction of NF-{kappa}B does require the activation of IKK.

Tumorigenesis of the lung, larynx, oral cavity and pharynx, esophagus, pancreas, kidney and bladder has been linked to CS (1,2,51). Our results show that CSC can activate NF-{kappa}B in myeloid, lymphoid, and head and neck squamous cells and in lung cells. These observations suggest that CS, through NF-{kappa}B activation, has the potential to initiate carcinogenic cascade in most cell types.

How activation of NF-{kappa}B by CSC contributes to carcinogenesis and tumorigenesis is not clear. Several genes that are regulated by NF-{kappa}B can contribute to carcinogenesis and atherogenesis including gene products which block apoptosis (e.g. TRAF1, TRAF2, cIAP-1, cIAP-2, XIAP, bcl-2 and bcl-xl), gene products which promote angiogenesis (e.g. cell surface adhesion molecules on endothelial cells, vascular endothelial cell growth factor, COX-2, matrix metalloprotease-9 and urokinase plasminogen activator), and inflammatory cytokines (e.g. TNF, IL-1, IL-6 and IL-8) (for refs, see 11). Indeed the expression of adhesion molecules in cultured endothelial cells by CSC has been reported (52,53). Our studies indicate that CSC can also induce the expression of COX-2 protein. Whether the induction of COX-2 by CSC is a direct result of NF-{kappa}B activation, however, is less clear from our studies. COX-2 has been implicated in carcinogenic process (54). Additionally, the levels of COX-2 have been shown to be over expressed in patients with lung cancer, head and neck cancer or breast cancer (55–58).

Our results indicate that exposure of cells for 15–30 min to 1–10 µg/ml CSC is sufficient to activate NF-{kappa}B. Whether the concentration of CSC used in our studies is achieved by cigarette smokers is not clear. One standard research cigarette can provide up to 10 mg of the CSC (3). Based on 20 cigarettes consumed per day by human (with a body weight of 70 kg), he/she receives ~6.8 mg smoke tar/kg body wt (59), resulting in exposure of lung cells to microgram quantities of tar. Thus, the cumulative dose of CS consumed by the smokers may be sufficient to activate NF-{kappa}B and induce gene expression.

The delineation of targets of CS, such as NF-{kappa}B as described here, suggests that suppression of NF-{kappa}B activation induced by CSC should diminish the CS-induced damage. CS is known to play a role not only in cancer but also in cardiovascular diseases and in COPD (60). NF-{kappa}B activation has been implicated in both cardiovascular diseases as well as in COPD (61–66). Therefore, it is possible that suppression of NF-{kappa}B induced by CSC may prove useful in those diseases as well.


    Notes
 
2 To whom correspondence should be addressed Email: aggarwal{at}utmdacc.mda.uth.tmc.edu Back


    Acknowledgments
 
This research was supported by The Clayton Foundation, the National Institute of Health (P01 CA91844), Institutional Tobacco Funds and from KTRB 5-41165.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1. Parkin,D.M. (1994) Cancer in developing countries. Cancer Sur., 19, 519–561.
  2. Wingo,P.A., Ries,L.A., Giovino,G.A., Miller,D.S., Rosenberg,H.M., Shopland,D.R, Thun,M.J. and Edwards,B.K. (1999) Annual report to the nation on the status of cancer, 1973–1996, with a special section on lung cancer and tobacco smoking. J Natl Cancer Inst., 91, 675–690.[Abstract/Free Full Text]
  3. Hoffmann,D., Hoffmann,I. and El-Bayomi,K. (2001) The less harmful cigarette: a controversial issue. A tribute to Ernst L. Wynder. Chem. Res. Toxicol., 14, 767–790.[ISI][Medline]
  4. Hecht,S.S. (1999) Tobacco smoke carcinogens and lung cancer. J. Natl Cancer Inst., 91, 1194–1210.[Abstract/Free Full Text]
  5. Denissenko,M.F., Pao,A., Tang,M. and Pfeifer,G.P. (1996) Preferential formation of benzo[a]pyrene adducts at lung cancer mutational hotspots in P53. Science, 274, 430–432.[Abstract/Free Full Text]
  6. Klein-Szanto,A.J., Iizasa,T., Momiki,S., Garcia-Palazzo,I. Caamano,J. Metcalf,R. Welsh,J. and Harris,CC. (1992) A tobacco-specific N-nitrosamine or cigarette smoke condensate causes neoplastic transformation of xenotransplanted human bronchial epithelial cells Proc. Natl Acad. Sci. USA, 89, 6693–6697.[Abstract/Free Full Text]
  7. Ghosh,S., May,M.J. and Kopp,E.B. (1998) NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol., 16, 225–260.[ISI][Medline]
  8. Karin,M. and Ben-Neriah,Y. (2000) Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity. Annu Rev Immunol., 18, 621–663.[ISI][Medline]
  9. Finco,T.S., Westwick,J.K., Norris,J.L., Beg,A.A., Der,J.C. and Baldwain,A.S. Jr (1997) Oncogenic Ha-Ras-induced signaling activates NF-kappaB transcriptional activity, which is required for cellular transformation. J. Biol. Chem., 272, 24113–24116.[Abstract/Free Full Text]
  10. Kim,D.W., Sovak,M.A., Zanieski,G. et al. (2000) Activation of NF-kappaB/Rel occurs early during neoplastic transformation of mammary cells. Carcinogenesis, 21, 871–879.[Abstract/Free Full Text]
  11. Pahl,H.L. (1999) Activators and target genes of Rel/NF-kB transcription factors. Oncogene, 18, 6853–6866.[ISI][Medline]
  12. Malinin,N.L., Boldin,M.P., Kovalenko,A.V. and Wallach,D. (1997) MAP3K-related kinase involved in NF-kappaB induction by TNF, CD95 and IL-1. Nature, 385, 540.[Medline]
  13. Darnay,B.G., Ni,J., Moore,P.A. and Aggarwal,B.B. (1999) Activation of NF-{kappa}B by RANK requires TRAF6 and NF-{kappa}B-inducing kinase (NIK): identification of a novel TRAF6 interaction motif J. Biol. Chem., 274, 7724.[Abstract/Free Full Text]
  14. Pillsbury,H.C. and Bright,C.C. (1972) Comparison of aliquot and complete sample procedure for the determination of nicotine in cigarette smoke. J. Assoc. Off. Anal. Chem., 55, 636–638.[Medline] 15Chaturvedi,M.M., Mukhopadhyay,A. and Aggarwal,B.B. (2000) Assay for redox-sensitive transcription factors Methods Enzymol., 319, 585–601.[ISI][Medline]
  15. Manna,S.K., Mukhopadhyay,A. and Aggarwal,B.B. (2000) Interferon-{alpha} suppresses activation of nuclear transcription factors NF-{kappa}B and AP-1 and potentiates TNF-induced apoptosis. J. Immunol., 164, 4927–4934.
  16. Baeuerle,P.A. and Baichwal,V.R. (1997) NF-kappa B as a frequent target for immunosuppressive and anti-inflammatory molecules Adv. Immunol., 65, 111.[ISI][Medline]
  17. Bonizzi,G., Piette,J., Merville,M.P. and Bours,V. (1997) Distinct signal transduction pathways mediate nuclear factor-{kappa}B induction by IL-1 beta in epithelial and lymphoid cells J. Immunol., 159, 5264.[Abstract]
  18. Bonizzi,G. (1999) Role of the protein kinase C lambda/iota isoform in nuclear factor-kappaB activation by interleukin-1beta or tumor necrosis factor-alpha: cell type specificities. Biochem. Pharm., 57, 713[ISI][Medline]
  19. Gustin,J.A., Maehama,T., Dixon,J.E. and Donner,D.B. (2001) The PTEN tumor suppressor protein inhibits tumor necrosis factor-induced nuclear factor kappa B activity. Biol. Chem., 276, 27740–27744.
  20. Henkel,T., Machleidt,T., Alkalay,I., Kronke,M., Ben-Neriah,Y. and Baeuerle,P.A. (1993) Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature, 365, 182–185.[Medline]
  21. Li,N. and Karin,M. (1998) Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc. Natl Acad. Sci. USA, 95, 13012–13017.[Abstract/Free Full Text]
  22. Canty,T.G. Jr, Boyle,E.M. Jr, Farr,A., Morgan,E.N., Verrier,E.D. and Pohlman,T.H. (1999) Oxidative stress induces NF-kappaB nuclear translocation without degradation of IkappaBalpha. Circulation, 100 (19 suppl.), II361.[Medline]
  23. Raju,U., Gumin,G.J, Noel,F. and Tofilon,P.J. (1998) IkappaB alpha degradation is not a requirement for the X-ray-induced activation of nuclear factor kappaB in normal rat astrocytes and human brain tumour cells. Int. J. Radiat. Biol., 74, 617.[ISI][Medline]
  24. Zwacka,R.M., Zhang,Y., Zhou,W., Halldorson,J. and Engelhardt,J.F. (1998) Ischemia/reperfusion injury in the liver of BALB/c mice activates AP-1 and nuclear factor kappaB independently of IkappaB degradation. Hepatology, 28, 1022.[ISI][Medline]
  25. Imbert,V., Rupec,R.A., Livolsi,A. et al. (1996) Tyrosine phosphorylation of I kappa B-alpha activates NF-kappa B without proteolytic degradation of I kappa B-alpha. Cell, 86, 787–798.[ISI][Medline]
  26. Traenckner,E.B., Pahl,H.L., Henkel,T., Schmidt,K.N., Wilk,S. and Baeuerle,P.A. (1995) Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J., 14, 2876–2883.[ISI][Medline]
  27. Mukhopadhyay,A., Manna,S.K. and Aggarwal,B.B. (2000) Pervanadate-induced nuclear factor-{kappa}B activation requires tyrosine phosphorylation and degradation of IkB a: comparison with tumor necrosis factor-{alpha}. J. Biol. Chem., 275, 8549.[Abstract/Free Full Text]
  28. Schoonbroodt,S., Ferreira,V., Best-Belpomme,M., Boelaert,J.R., Legrand-Poels,S., Korner,M. and Piette,J. (2000) Crucial role of the amino-terminal tyrosine residue 42 and the carboxyl-terminal PEST domain of I kappa B alpha in NF-kappa B activation by an oxidative stress. J. Immunol., 164, 4292–4300.[Abstract/Free Full Text]
  29. Livolsi,A., Busuttil,V., Imbert,V., Abraham,R.T. and Peyron,J.F. (2001) Tyrosine phosphorylation-dependent activation of NF-kappa B. Requirement for p56 LCK and ZAP-70 protein tyrosine kinases. Eur. J. Biochem., 268, 1508–1515.[ISI][Medline]
  30. Li,Z.W., Chu,W., Hu,Y., Delhase,M., Deerinck,T., Ellisman,M, Johnson,R. and Karin,M. (1999) The IKKbeta subunit of IkappaB kinase (IKK) is essential for nuclear factor kappaB activation and prevention of apoptosis. J. Exp. Med., 189, 1839–1845.[Abstract/Free Full Text]
  31. Nasuhara,Y., Adcock,I.M., Catley,M., Barnes,P.J. and Newton,R. (1999) Differential IkappaB kinase activation and IkappaBalpha degradation by interleukin-1beta and tumor necrosis factor-alpha in human U937 monocytic cells. Evidence for additional regulatory steps in kappaB-dependent transcription. J. Biol. Chem., 274, 19965.[Abstract/Free Full Text]
  32. Hsu,H., Shu,H.B, Pan,M.G. and Goeddel,D.V. (1996) TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways. Cell, 84, 299.[ISI][Medline]
  33. Devin,A., Lin,Y., Yamaoka,S., Li,Z., Karin,M. and Liu,Zg. (2001) The alpha and beta subunits of IkappaB kinase (IKK) mediate TRAF2-dependent IKK recruitment to tumor necrosis factor (TNF) receptor 1 in response to TNF. Mol. Cell. Biol., 21, 3986–3994.[Abstract/Free Full Text]
  34. Plummer,S.M., Holloway,K.A., Manson,M.M., Munks,R.J., Kaptein,A., Farrow,S. and Howells,L. (1999) Inhibition of cyclo-oxygenase 2 expression in colon cells by the chemopreventive agent curcumin involves inhibition of NF-kappaB activation via the NIK/IKK signalling complex. Oncogene, 18, 6013–6020.[ISI][Medline]
  35. Green,C.R. and Rodgman,A. (1996) The tobacco chemists' research conference: a half century of advances in analytical methodology of tobacco and its products. Recent Adv. Tob. Sci., 22, 131–304
  36. Shinagawa,K., Tokimoto,T. and Shirane,K. (1998) Spin trapping of nitric acid in aqueous solutions of cigarette smoke. Biochem. Biophys. Res. Commun., 253, 99–103.[ISI][Medline]
  37. Pryor,W.A., Stone,K., Zang,L. and Bermudez,E., (1998) Fractionation of aqueous cigarette tar extracts: fractions that contain the tar radical cause DNA damage. Chemical Res. Toxicol., 11, 441–448.[ISI][Medline]
  38. Pryor,W.A. (1997) Cigarette smoke radicals and the role of free radicals in chemical carcinogenicity. Environ. Health Perspect., 105 (suppl. 4), 875–882.[ISI][Medline]
  39. Smith,C.J., Livingston,S.D. and Doolittle,D.J. (1997) An international literature survey of `IARC Group I carcinogens' reported in mainstream cigarette smoke. Food Chem. Toxicol., 35, 1107–1130.[ISI][Medline]
  40. Hecht,S.S. (1999) Tobacco smoke carcinogens and lung cancer. J. Natl Cancer Inst., 91, 1194–1210.[Abstract/Free Full Text]
  41. Castonguay,A., Pepin,P. and Stoner,G.D. (1991) Lung tumorigenicity of NNK given orally to A/J mice: its application to chemopreventive efficacy studies. Exp. Lung Res., 17, 485–499.[ISI][Medline]
  42. Nakayama,N., Church,D.F. and Pryor,W.A. (1989) Quantitative analysis of the hydrogen peroxide formed in equeous cigarette tar extracts. Free Radical Biol. Med., 7, 9–15.[ISI][Medline]
  43. Dooley,M.M. and Pryor,W.A. (1982) Free radical pathology: inactivation of human alpha-1-proteinase inhibitor by products from the reaction of nitrogen dioxide with hydrogen peroxide and the etiology of emphysema. Biochem. Biophys. Res. Commun., 106, 981–987.[ISI][Medline]
  44. Pei,X.H., Nakanishi,Y., Takayama,K., Bai,F. and Hara,N. (1999) Benzo[a]pyrene activates the human p53 gene through induction of nuclear factor kappaB activity. J. Biol. Chem., 274, 35240–35246.[Abstract/Free Full Text]
  45. Yan,Z., Subbaramaiah,K., Camilli,T., Zhang,F., Tanabe,T., McCaffrey,T.A., Dannenberg,A.J. and Weksler,B.B. (2000) Benzo[a]pyrene induces the transcription of cyclooxygenase-2 in vascular smooth muscle cells. Evidence for the involvement of extracellular signal-regulated kinase and NF-kB. J. Biol. Chem., 275, 4949–4955[Abstract/Free Full Text]
  46. Gebel,S. and Muller,T. (2001) The activity of NF-kappaB in Swiss 3T3 cells exposed to aqueous extracts of cigarette smoke is dependent on thioredoxin. Toxicol. Sci., 59, 75–81.[Abstract/Free Full Text]
  47. Ting,A.T., Pimentel-Muinos,F.X. and Seed,B.(1996) RIP mediates tumor necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis. EMBO J., 15, 6189–6196.[ISI][Medline]
  48. Kelliher,M.A., Grimm,S., Ishida,Y., Kuo,F., Stanger,B.Z. and Leder,P. (1998) The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity, 8, 297–303.[ISI][Medline]
  49. Yang,J., Lin,Y., Guo,Z., Cheng,J., Huang,J., Deng,L., Liao,W., Chen,Z., Liu,Zg. and Su,B. (2001) The essential role of MEKK3 in TNF-induced NF-kappaB activation. Nat. Immunol., 2, 620–624.[ISI][Medline]
  50. Rivenson,A., Hoffmann,D., Prokopczyk,B., Amin,S. and Hecht,S.S. (1988) Induction of lung and exocrine pancreas tumors in F344 rats by tobacco-specific and Areca-derived N-nitrosamines. Cancer Res., 48, 6912–6917.[Abstract/Free Full Text]
  51. Kalra,V.K., Ying,Y., Deemer,K., Natarajan,R., Nadler,J.L. and Coates,T.D. (1994) Mechanism of cigarette smoke condensate induced adhesion of human monocytes to cultured endothelial cells. J. Cell. Physiol., 160, 154–162.[ISI][Medline]
  52. Shen,Y., Rattan,V., Sultana,C. and Kalra,V.K. (1996) Cigarette smoke condensate-induced adhesion molecule expression and transendothelial migration of monocytes. Am. J. Physiol., 270, H1624–H1633.[Medline]
  53. Prescott,S.M. and Fitzpatrick,F.A. (2000) Cyclooxygenase-2 and carcinogenesis. Biochim. Biophys. Acta, 1470, M69–M78.[Medline]
  54. Hida,T., Yatabe,Y., Achiwa,H., Muramatsu,H., Kozaki,K., Nakamura,S., Ogawa,M., Mitsudomi,T., Sugiura,T. and Takahashi,T. (1998) Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res., 58, 3761–3764.[Abstract/Free Full Text]
  55. Harris,R.E., Alshafie,G.A., Abou-Issa,H. and Seibert,K. (2000) Chemoprevention of breast cancer in rats by celecoxib, a cyclooxygenase 2 inhibitor. Cancer Res., 60, 2101–2103.[Abstract/Free Full Text]
  56. Tsujii,M., Kawano,S. and DuBois,R.N. (1997) Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc. Natl Acad. Sci. USA, 94, 3336–33340.[Abstract/Free Full Text]
  57. Jaeckel,E.C., Raja,S., Tan,J., Das,S.K., Dey,S.K., Girod,D.A., Tsue,T.T. and Sanford,T.R. (2001) Correlation of expression of cyclooxygenase-2, vascular endothelial growth factor and peroxisome proliferator-activated receptor delta with head and neck squamous cell carcinoma. Arch. Otolaryngol. Head Neck Surg., 127, 1253–1259.[Abstract/Free Full Text]
  58. Binns,R. (1977) Inhalation toxicity studies on cigarette smoke. IV. Expression of the dose of smoke particulate material to the lungs of experimental animals. Toxicology, 7, 189–195.[ISI][Medline]
  59. Teramoto,S. and Kume,H. (2001) The role of nuclear factor-kappa B activation in airway inflammation following adenovirus infection and COPD [Letter]. Chest, 119, 1294–1295.[Medline]
  60. Bureau,F., Bonizzi,G., Kirschvink,N., Delhalle,S., Desmecht,D., Merville,M.P., Bours,V. and Lekeux,P. (2000) Correlation between nuclear factor-kappaB activity in bronchial brushing samples and lung dysfunction in an animal model of asthma. Am. J. Resp. Crit. Care Med., 161, 1314–1321.[Abstract/Free Full Text]
  61. Feeley,B.T., Miniati,D.N., Park,A.K., Hoyt,E.G. and Robbins,R.C. (2000) Nuclear factor-kappaB transcription factor decoy treatment inhibits graft coronary artery disease after cardiac transplantation in rodents. Transplantation, 70, 1560–1568.[ISI][Medline]
  62. Hajra,L., Evans,A.I., Chen,M., Hyduk,S.J., Collins,T. and Cybulsky,M.I. (2000) The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation. Proc. Natl Acad. Sci. USA, 97, 9052–9057.[Abstract/Free Full Text]
  63. Li,C., Browder,W. and Kao,R.L. (1999) Early activation of transcription factor NF-kappaB during ischemia in perfused rat heart. Am J Physiol., 276, H543–H552.[Medline]
  64. Morishita,R., Sugimoto,T., Aoki,M. et al. (1997) In vivo transfection of cis element `decoy' against nuclear factor-kappaB binding site prevents myocardial infarction. Nat. Med., 3, 894–899.[ISI][Medline]
  65. Sawa,Y., Morishita,R., Suzuki,K., Kagisaki,K., Kaneda,Y., Maeda,K., Kadoba,K. and Matsuda,H. (1997) A novel strategy for myocardial protection using in vivo transfection of cis element `decoy' against NFkappaB binding site: evidence for a role of NFkappaB in ischemia-reperfusion injury. Circulation, 96 (9 suppl.), II280–II284.
Received January 14, 2002; revised March 13, 2002; accepted April 8, 2002.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Eur Respir JHome page
K. F. Chung and I. M. Adcock
Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction
Eur. Respir. J., June 1, 2008; 31(6): 1334 - 1356.
[Abstract] [Full Text] [PDF]


Home page